Search Products from 10 Million+
Range of ELISA Kits, Antibodies, Biochemicals, Recombinant Proteins & Assay Kits
Description
Category | Molecular Biology Product |
---|---|
Pack Size | 10 ug plasmid + 200ul Glycerol |
Gene ID | 10397 |
Accesession Number | BC006260 |
Vector | pENTR223.1 |
Sequence | atggcggactgtggcggcctcccgcagatctcccagccggccaagctcgctgaggccttcaagtacttcgtgcagggcatgggatacatgccctcggctagcatgacccgcctgatgcggtcccgcacagcctctggttccagcgtcacttctctggatggcacccgcagccgctcccacaccagcgagggcacccgaagccgctcccacaccagcgagggcacccgcagccgctcgcacaccagcgagggggcccacctggacatcacccccaactcgggtgctgctgggaacagcgccgggcccaagtccatggaggtctcctgctag |
Length | 330 |
Note | This product is for research use only. |


Subscribe to our newsletter
Drop your email address to get regular updates about discounts and offers