Search Products from 10 Million+
Range of ELISA Kits, Antibodies, Biochemicals, Recombinant Proteins & Assay Kits
Description
Category | Molecular Biology Product |
---|---|
Pack Size | 10 ug plasmid + 200ul Glycerol |
Gene ID | 6288 |
Accesession Number | BC007022 |
Vector | pENTR223.1 |
Sequence | atgaagcttctcacgggcctggttttctgctccttggtcctgggtgtcagcagccgaagcttcttttcgttccttggcgaggcttttgatggggctcgggacatgtggagagcctactctgacatgagagaagccaattacatcggctcagacaaatacttccatgctcgggggaactatgatgctgccaaaaggggacctgggggtgtctgggctgcagaagcgatcagcgatgccagagagaatatccagagattctttggccatggtgcggaggactcactggccgatcaggctgccgatgaatggggcaggagtggcaaagaccccaatcacttccgacctgctggcctgcctgagaaatactga |
Length | 369 |
Note | This product is for research use only. |
![SVG](https://biotechnolabs.com/public/frontend/assets/img/alert-bg.png)
![SVG](https://biotechnolabs.com/public/frontend/assets/img/circle.png)
Subscribe to our newsletter
Drop your email address to get regular updates about discounts and offers