Your Cart
Product Title

2 x $5566

Search Products from 10 Million+
Range of Elisa Kits, Antibodies, Biochemicals, Recombinant Proteins & Assay Kits



Cat No:CSB-CL011659HU | Brand:Cusabio

Share Item:

Quick Enquiry


Category Molecular Biology Product
Pack Size 10 ug plasmid + 200ul Glycerol
Gene ID 3565
Accesession Number BC067514
Vector pENTR223.1
Sequence atgggtctcacctcccaactgcttccccctctgttcttcctgctagcatgtgccggcaactttgtccacggacacaagtgcgatatcaccttacaggagatcatcaaaactttgaacagcctcacagagcagaagactctgtgcaccgagttgaccgtaacagacatctttgctgcctccaagaacacaactgagaaggaaaccttctgcagggctgcgactgtgctccggcagttctacagccaccatgagaaggacactcgctgcctgggtgcgactgcacagcagttccacaggcacaagcagctgatccgattcctgaaacggctcgacaggaacctctggggcctggcgggcttgaattcctgtcctgtgaaggaagccaaccagagtacgttggaaaacttcttggaaaggctaaagacgatcatgagagagaaatattcaaagtgttcgagctga
Length 462
Note This product is for research use only.

Subscribe to our newsletter

Drop your email address to get regular updates about discounts and offers