Search Products from 10 Million+
Range of ELISA Kits, Antibodies, Biochemicals, Recombinant Proteins & Assay Kits
Description
| Category | Molecular Biology Product |
|---|---|
| Pack Size | 10 ug plasmid + 200ul Glycerol |
| Gene ID | 4828 |
| Accesession Number | BC007407 |
| Vector | pENTR223.1 |
| Sequence | atggcccggcgggcggggggcgctcggatgttcggcagcctcctgctcttcgccctgctcgctgccggcgtcgccccgctcagctgggatctcccggagccccgcagccgagccagcaagatccgagtgcactcgcgaggcaacctctgggccaccggtcacttcatgggcaagaagagtctggagccttccagcccatccccattggggacagctacccacacctccctgagggaccagcgactgcagctgagtcatgatctgctcggaatcctcctgctaaagaaggctctgggcgtgagcctcagccgccccgcaccccaaatccaggaggctgctggtacaaatactgcagaaatgacaccaataatggggcagacacaacagcgtggcttagattgtgcccacccagggaaggtgctgaatgggaccctgttgatggccccatctggatgtaaatcctga |
| Length | 465 |
| Note | This product is for research use only. |
Subscribe to our newsletter
Drop your email address to get regular updates about discounts and offers