Your Cart
Product
Product Title

2 x $5566
Total:$11132.00
SVG
SVG

Search Products from 10 Million+
Range of Elisa Kits, Antibodies, Biochemicals, Recombinant Proteins & Assay Kits

SVG

ZNHIT1

Cat No:CSB-CL027109HU | Brand:Cusabio

Share Item:

Quick Enquiry

Description

Category Molecular Biology Product
Pack Size 10 ug plasmid + 200ul Glycerol
Gene ID 10467
Accesession Number BC017333
Vector pENTR223.1
Sequence atggtggagaagaaaacttcggttcgctcccaggaccccgggcagcggcgggtgctggaccgggctgcccggcagcgtcgcatcaaccggcagctggaggccctggagaatgacaacttccaggatgacccccacgcgggactccctcagctcggcaagagactgcctcagtttgatgacgatgcggacactggaaagaaaaagaagaaaacccgaggtgatcattttaaacttcgcttccgaaaaaactttcaggccctgttggaggagcagaacttgagtgtggccgagggccctaactacctgacggcctgtgcgggacccccatcgcggccccagcgccccttctgtgctgtctgtggcttcccatccccctacacctgtgtcagctgcggtgcccggtactgcactgtgcgctgtctggggacccaccaggagaccaggtgtctgaagtggactgtgtga
Length 465
Note This product is for research use only.
SVG
SVG

Subscribe to our newsletter

Drop your email address to get regular updates about discounts and offers